View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16107_low_8 (Length: 270)
Name: NF16107_low_8
Description: NF16107
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16107_low_8 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 181; Significance: 7e-98; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 181; E-Value: 7e-98
Query Start/End: Original strand, 8 - 252
Target Start/End: Complemental strand, 3713841 - 3713597
Alignment:
| Q |
8 |
gacatcatcaaatcttataaaacaatcgtaaaatgattatcaacgacaccgttattaagaagaacttttcctccagcaactttataaatgtgaagttgaa |
107 |
Q |
| |
|
|||| |||||||||| |||||| ||| |||||||||||||||||||||| ||||||| ||||||||||||| || | ||||||||||||| |||||||| |
|
|
| T |
3713841 |
gacaacatcaaatctcataaaataattgtaaaatgattatcaacgacactattattaataagaacttttccttcaacgactttataaatgtaaagttgaa |
3713742 |
T |
|
| Q |
108 |
tttgatcaaattagggtattctactattatttttgtaaaagttgcactttagactttcaatgaaatcataatatcatcataatttcttaacttaccgtaa |
207 |
Q |
| |
|
|||| |||||||||||||| |||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
3713741 |
tttggtcaaattagggtatgctactattatttttataaaagttgcactttagactttcaatgaaatcataatatcatcataatttcaaaacttaccgtaa |
3713642 |
T |
|
| Q |
208 |
cttcaaacatgcactaagtagcctggtcggtaaataaagacatcg |
252 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3713641 |
cttcaaacatgcactaagtagcctggtcggtaaataaagacatcg |
3713597 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University