View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16107_low_9 (Length: 249)
Name: NF16107_low_9
Description: NF16107
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16107_low_9 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 163; Significance: 4e-87; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 163; E-Value: 4e-87
Query Start/End: Original strand, 75 - 245
Target Start/End: Original strand, 1836270 - 1836440
Alignment:
| Q |
75 |
tatcccctccttgctgatctaagatttccaaataaaaccttaattatatgagattccacgaatttgaattagtggtattctaaaatcccatgacacctaa |
174 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
1836270 |
tatcccctccttgctgatcaaagatttccaaataaaaccttaattatatgagattccacgaatttggattagtggtattctaaaatcccatgacacctaa |
1836369 |
T |
|
| Q |
175 |
gttctgaaaacgcgttatgaaacaggggactgaattgtgtcacttaatccaattctttattattgctccat |
245 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1836370 |
gttctgaaaacgcgttatgaaacaggggactgaattgtgtcacttaatccaattctttattattgctccat |
1836440 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 67; E-Value: 7e-30
Query Start/End: Original strand, 10 - 76
Target Start/End: Original strand, 1836174 - 1836240
Alignment:
| Q |
10 |
aagaaaatctagggtctcacaagacttatgaatcttacagtgtgtactgataaataaacataaagta |
76 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1836174 |
aagaaaatctagggtctcacaagacttatgaatcttacagtgtgtactgataaataaacataaagta |
1836240 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University