View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16108_low_6 (Length: 260)
Name: NF16108_low_6
Description: NF16108
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16108_low_6 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 222; Significance: 1e-122; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 222; E-Value: 1e-122
Query Start/End: Original strand, 19 - 244
Target Start/End: Original strand, 39170264 - 39170489
Alignment:
| Q |
19 |
gggttgttggcttgaatcccagatatggattgaagaagtcctagattgtgtagagagtgtctcactttaatagaagcaaaagagtcattagtgagcaaga |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39170264 |
gggttgttggcttgaatcccagatatggattgaagaagtcctagattgtgtagagagtgtctcactttaatagaagcaaaagagtcattagtgagcaaga |
39170363 |
T |
 |
| Q |
119 |
gaagtggccaagtgagcctaacacagttgaaacccatagattttattccctttgaaattacatcaagaggttgatggctcaaaccctcagccactgaggt |
218 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39170364 |
gaagtggccaagtgagcctaacacagttgaaacccatggattttattccctttgaaattacatcaagaggttgatggctcaaaccctcagccactgaggt |
39170463 |
T |
 |
| Q |
219 |
atctaaatgtgatgcccaattaacac |
244 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
39170464 |
atctaaatgtgatgcccaattaacac |
39170489 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 124 - 182
Target Start/End: Original strand, 37315576 - 37315634
Alignment:
| Q |
124 |
ggccaagtgagcctaacacagttgaaacccatagattttattccctttgaaattacatc |
182 |
Q |
| |
|
||||||||||||||||||||||| || ||||| || |||||||| || ||||| ||||| |
|
|
| T |
37315576 |
ggccaagtgagcctaacacagttaaatcccatggactttattccattagaaataacatc |
37315634 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University