View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1610_low_8 (Length: 358)
Name: NF1610_low_8
Description: NF1610
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1610_low_8 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 158; Significance: 5e-84; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 158; E-Value: 5e-84
Query Start/End: Original strand, 18 - 196
Target Start/End: Original strand, 25506639 - 25506817
Alignment:
| Q |
18 |
gttctgtttcctttaatagtaagttgactttnnnnnnngcacttttttgttacttatagagtgagcttttgtgtgtataaaatacccttttgaaagtact |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25506639 |
gttctgtttcctttaatagtaagttgactttaaaaaaagcacttttttgttacttatagagtgagcttttgtgtgtataaaatacccttttgaaagtact |
25506738 |
T |
|
| Q |
118 |
tttcaattatcatgtcaaatgtggttttaaccattcatgcatctttgtagtttcttagctagcagcatagttaaagttg |
196 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25506739 |
tttcaattatcatgtcaaatgtggttttaaccattcatgcatctttgtagtttcttagctagcagcatagttaaagttg |
25506817 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 56; E-Value: 4e-23
Query Start/End: Original strand, 269 - 324
Target Start/End: Original strand, 25506890 - 25506945
Alignment:
| Q |
269 |
cattgcagagagaagattaactattagagcagctgaaactgatgcaaatgaaggtt |
324 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25506890 |
cattgcagagagaagattaactattagagcagctgaaactgatgcaaatgaaggtt |
25506945 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University