View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1611-INSERTION-1 (Length: 225)
Name: NF1611-INSERTION-1
Description: NF1611
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1611-INSERTION-1 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 142; Significance: 1e-74; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 142; E-Value: 1e-74
Query Start/End: Original strand, 8 - 161
Target Start/End: Original strand, 1421059 - 1421212
Alignment:
| Q |
8 |
tgaacaatttgtaattttatttttggattgcatactatttgtcccaaaactaatctaaactacatgatgaacaaccccacttaacatgatgttatacagg |
107 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| ||||| |||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
1421059 |
tgaacaatttgtaattttatttttggattgcatactatttgtcacaaaaataatctaaactacatgatgaacaaccccacttaacatgatgttatatagg |
1421158 |
T |
|
| Q |
108 |
gaagaaccctattatggatggtctccttgctagttgatttaaaaattaaattat |
161 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1421159 |
gaagaaccctattatggatggtctccttgctagttgatttaaaaattaaattat |
1421212 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 96; E-Value: 3e-47
Query Start/End: Original strand, 8 - 204
Target Start/End: Original strand, 1414660 - 1414858
Alignment:
| Q |
8 |
tgaacaatttgtaattttatttttggattgcatactatttgtcccaaaactaatctaaactacatgatgaacaaccccacttaacatgatgt-tatacag |
106 |
Q |
| |
|
||||||| |||||||||||||||||||||| ||||| ||| |||||||| ||||||||||||||||| |||||||||||||| ||| ||||| |||| | |
|
|
| T |
1414660 |
tgaacaacttgtaattttatttttggattggatactttttatcccaaaattaatctaaactacatgacgaacaaccccactttacacgatgtatata-gg |
1414758 |
T |
|
| Q |
107 |
ggaagaac-cctattatggatggtctccttgctagttgatttaaaaattaaattataatcctcgt-gaaacgatattatacttactcttattagttgtta |
204 |
Q |
| |
|
|||||||| ||| |||||||||||||||||| |||| ||||||| ||| ||| ||||| |||||| ||||||||| ||||||||||||||||| |||||| |
|
|
| T |
1414759 |
ggaagaactcctcttatggatggtctccttgatagtggatttaacaatcaaactataaccctcgtggaaacgatactatacttactcttattacttgtta |
1414858 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 192 - 225
Target Start/End: Original strand, 1421209 - 1421242
Alignment:
| Q |
192 |
ttattagttgttactgtttgattaaacttgctca |
225 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||| |
|
|
| T |
1421209 |
ttattagttgttactgattgattaaacttgctca |
1421242 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University