View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16110_high_2 (Length: 387)
Name: NF16110_high_2
Description: NF16110
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16110_high_2 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 307; Significance: 1e-173; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 307; E-Value: 1e-173
Query Start/End: Original strand, 22 - 376
Target Start/End: Original strand, 18472887 - 18473241
Alignment:
| Q |
22 |
gttcggtgatactcgagcacttgtcatgttgtagacacgtggcttcattaaacagtaaatttcaccgaggagacaaaggtgtcgggcaccttgagcattt |
121 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |||||||||||||||||||||| ||||||||||||| |
|
|
| T |
18472887 |
gttcggtgatactcgagcacttgtcatgttgtagatacgtggcttcattaaacagtaaatttcgccgaggagacaaaggtgtcggggaccttgagcattt |
18472986 |
T |
 |
| Q |
122 |
ttggttcgtcgatattttgaatatcaccaatttggggttgtccccttcagttctgcgnnnnnnnntgtcttcatcgttagttttaatagacaattgcact |
221 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
18472987 |
ttggttcgtcgatattttgaatatcaccaatttggggttgtccccttcagttctgcgaaaaaaaatgtcttcatcgttagttttaatagacaattgcact |
18473086 |
T |
 |
| Q |
222 |
gtattggtccaattgtccaagtttttgttcgtggataataagtgtaaatgaaccatgcccctcaaaatggacttgtcatgacatcttgtggtaactatcc |
321 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
18473087 |
gtattggtccaattgtccaagtttttgttcgcggataataagtgtaaatgaaccatgcccctcaaaatggacttgtcatggcatcttgtggtaactatcc |
18473186 |
T |
 |
| Q |
322 |
ataagtgtaatacaatattaaatatgtaaccaatgtatggtaactgtcgagtata |
376 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
18473187 |
ataagtgtaatacaatattaaatatgtaaccaatgtatggtaactgtcaagtata |
18473241 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University