View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16110_low_5 (Length: 223)
Name: NF16110_low_5
Description: NF16110
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16110_low_5 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 170; Significance: 2e-91; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 170; E-Value: 2e-91
Query Start/End: Original strand, 14 - 208
Target Start/End: Complemental strand, 6366920 - 6366726
Alignment:
| Q |
14 |
caaaggaaaccgtgcgaccaatggcattgaaccggtgcaccnnnnnnngtctttgcctgagccacacgaaacctgtgacacggttgatacccatttccac |
113 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6366920 |
caaaggaaaccgtgcgaccgatggcattgaaccggtgcacctttttttgtctttgcctgagccacacgaaacctgtgacacggttgatacccatttccac |
6366821 |
T |
|
| Q |
114 |
aatgttgtccaaaggaagcaatcctcttggaagcaacatttcgtctaggagaagccgtgatttttgcttgcatattgcttcccccttgaatatct |
208 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6366820 |
aatgttgtccaaaggaagcaatcctcttggaagcaacatttcgtctaggagaagccgtgatttttgcttgcatattgcttcccccttgaatatct |
6366726 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University