View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16110_low_6 (Length: 213)
Name: NF16110_low_6
Description: NF16110
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16110_low_6 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 145; Significance: 2e-76; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 145; E-Value: 2e-76
Query Start/End: Original strand, 18 - 198
Target Start/End: Complemental strand, 8764389 - 8764208
Alignment:
| Q |
18 |
aagggtttatgaggttttggtttgattatgagtgaggtttatgtccttgattttagtgcctttatatagaggnnnnnnn-gtggtggttaacatgtaaac |
116 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |||||||| |
|
|
| T |
8764389 |
aagggtttatgaggttttggtttgattatgagtgaggtttatgtccttgattttagtgcctttatatagagaaaaaaaaagtggtggttaaaatgtaaac |
8764290 |
T |
|
| Q |
117 |
tatttgagactgctcaccatgtcatacttttccaacttagcctatggatttgcttgaaatttccatgcacgtcttgattcat |
198 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8764289 |
tatttgagactgctcaccatgtcatacttttccaacttagcctatggatttgcttgaaatttccatgcacgtcttgattcat |
8764208 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University