View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16112_high_46 (Length: 265)
Name: NF16112_high_46
Description: NF16112
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16112_high_46 |
 | |
|
| [»] chr2 (2 HSPs) |
| |
|
Alignment Details
Target: chr2 (Bit Score: 126; Significance: 5e-65; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 126; E-Value: 5e-65
Query Start/End: Original strand, 132 - 265
Target Start/End: Original strand, 40787879 - 40788012
Alignment:
| Q |
132 |
gaaccggagaaatgaagtcaactttcttcttcgttttaatagcaaggttatctctgagttttccagcatcgacggttccggtgacggttaactttccgcc |
231 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40787879 |
gaaccggagaaatgaagtcaactttcttcttcgttttaatagtaaggttatctctgagttttccagcatcgacggttccggtgacggttaactttccgcc |
40787978 |
T |
|
| Q |
232 |
attaccaatatcaagtttttcgaagccttcaata |
265 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||| |
|
|
| T |
40787979 |
attaccaatatcaagtttctcgaagccttcaata |
40788012 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 18 - 62
Target Start/End: Original strand, 40787765 - 40787809
Alignment:
| Q |
18 |
agaataaaagatgtaaataatagaacagagaaaataaaattacct |
62 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40787765 |
agaataaaagatgtaaataatagaacagagaaaataaaattacct |
40787809 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University