View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16112_low_21 (Length: 380)
Name: NF16112_low_21
Description: NF16112
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16112_low_21 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 253; Significance: 1e-140; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 253; E-Value: 1e-140
Query Start/End: Original strand, 1 - 365
Target Start/End: Original strand, 26776312 - 26776677
Alignment:
| Q |
1 |
ctgtttatctttgctttgctttgctttggaaatttgtttttagattgttattatttacaacttacatgcatggctgttaataacataataatgataagat |
100 |
Q |
| |
|
||||||||||||||||||||||| | |||| |||||||||||||| ||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
26776312 |
ctgtttatctttgctttgctttggtaacttaatt-gtttttagattgttgttatttacaacttacattcatggctgttaataacataataatgataagat |
26776410 |
T |
 |
| Q |
101 |
actaattaaggtgaagctttcggtcttttggtgttggctggagaccttggagtgtgctctatcaaggtcttagagactcgattatctcgggtgctagttt |
200 |
Q |
| |
|
||||||||||||||||||||| |||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
26776411 |
actaattaaggtgaagctttcagtctttaggtgttggctggagaccttggagtgtgctctatcaaggtcttagagactcgattatctcgattgctagttt |
26776510 |
T |
 |
| Q |
201 |
agggtttagggtttgagtttcttgaattagttttgatggactccttnnnnnnnnnnggtgtgaaggtttggtgcaac----ttacatgtcataattgaaa |
296 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||| ||||||||||| ||||||||||||||||||| |
|
|
| T |
26776511 |
agggtttagggtttgagtttcttgaattagttttgatggactcctt--aaaaaaaaggtgtgaagttttggtgcaacttaattacatgtcataattgaaa |
26776608 |
T |
 |
| Q |
297 |
aagtgctaattgtaatccatgtataaggagttatacatcaaataacttaattatttctagagctttatc |
365 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
26776609 |
aagtgctaattgtaatccatgtataaggagttatacatcaaataatttaattatttctagagctttatc |
26776677 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University