View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16112_low_28 (Length: 351)
Name: NF16112_low_28
Description: NF16112
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16112_low_28 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 221; Significance: 1e-121; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 221; E-Value: 1e-121
Query Start/End: Original strand, 105 - 341
Target Start/End: Original strand, 32858928 - 32859164
Alignment:
| Q |
105 |
atacactcaactatactctattatctcagttttggtgagctcaatcaaactttagatgttttttcctggtgaatgaactttagattaaattaattctatt |
204 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32858928 |
atacactcaactatactctattatctcagttttggtgagctcaatcaaactttagatgttttttcctggtgaatgaactttagattaaattaattctatt |
32859027 |
T |
 |
| Q |
205 |
ttattcatatgtgatatcttgatttccatttatgcttgcgttctccattaggatatatcaatttctgttttactttataaggtcaaatatggcattgaat |
304 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |||||||||||||||| |||||||||||||||||||| |
|
|
| T |
32859028 |
ttattcatatgtgatatcttgatttccatttatgcttgctttctccattaggatatatcaatatctgttttactttatagggtcaaatatggcattgaat |
32859127 |
T |
 |
| Q |
305 |
tgcgatgatccaggtcaatcaatccactagcaggtat |
341 |
Q |
| |
|
|| |||||||||||||||||||||||||||||||||| |
|
|
| T |
32859128 |
tgtgatgatccaggtcaatcaatccactagcaggtat |
32859164 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 16 - 70
Target Start/End: Original strand, 32858887 - 32858941
Alignment:
| Q |
16 |
cattcatatttatatctaagttttgtttttaaagaaattaaatacactcaactat |
70 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32858887 |
cattcatatttatatctaagttttgtttttaaagaaattaaatacactcaactat |
32858941 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University