View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16112_low_39 (Length: 302)
Name: NF16112_low_39
Description: NF16112
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16112_low_39 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 178; Significance: 5e-96; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 178; E-Value: 5e-96
Query Start/End: Original strand, 119 - 300
Target Start/End: Original strand, 40788093 - 40788274
Alignment:
| Q |
119 |
gttgatgaatataatttaggaatgagagaaaaagtagcaaccttcgaaaccttggatgaatttgacgattttggaagaacaaccttcacaatgcatgtcg |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40788093 |
gttgatgaatataatttaggaatgagagaaaaagtagcaaccttcgaaaccttggatgaatttgacgattttggaagaacaaccttcacaatgcatgtcg |
40788192 |
T |
 |
| Q |
219 |
accttcaaaatgacgttagttggtttcgtttcattctttttattattctcgttcttcttattgttgttgttattgatgatgt |
300 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40788193 |
accttcaaaatgacgttagttggtttcgtttcattatttttattattctcgttcttcttattgttgttgttattgatgatgt |
40788274 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 1 - 58
Target Start/End: Original strand, 40787976 - 40788033
Alignment:
| Q |
1 |
gccattaccaatatcaagtgtttcgaagccttcaataagaaggttcaatgcttcagtt |
58 |
Q |
| |
|
||||||||||||||||||| | |||||||||||||||||||||||||||||||||||| |
|
|
| T |
40787976 |
gccattaccaatatcaagtttctcgaagccttcaataagaaggttcaatgcttcagtt |
40788033 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University