View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16112_low_69 (Length: 224)
Name: NF16112_low_69
Description: NF16112
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16112_low_69 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 129; Significance: 6e-67; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 129; E-Value: 6e-67
Query Start/End: Original strand, 20 - 152
Target Start/End: Original strand, 3590342 - 3590474
Alignment:
| Q |
20 |
agtatgtctttgactagtggtacatatggattggaaaattaaatgagtattatgtcggaagtaatacattgactaagggaaaatttattccctaataggg |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
3590342 |
agtatgtctttgactagtggtacatatggattggaaaattaaatgagtattatgtcggaagtaatacattgactaagggaaaatttattctctaataggg |
3590441 |
T |
|
| Q |
120 |
acatatttgattatttttaaaaaatacatatta |
152 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
3590442 |
acatatttgattatttttaaaaaatacatatta |
3590474 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University