View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16113_low_3 (Length: 281)
Name: NF16113_low_3
Description: NF16113
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16113_low_3 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 242; Significance: 1e-134; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 242; E-Value: 1e-134
Query Start/End: Original strand, 19 - 260
Target Start/End: Complemental strand, 4109469 - 4109228
Alignment:
| Q |
19 |
gacggaagcaagatcatcgtcatcgtcagacgacaaagaggcgatctcgttgtcgtctaattcgatgacggtgggattaacacctatggtggagagaagc |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4109469 |
gacggaagcaagatcatcgtcatcgtcagacgacaaagaggcgatctcgttgtcgtctaattcgatgacggtgggattaacacctatggtggagagaagc |
4109370 |
T |
|
| Q |
119 |
ttcttcatgacatgacacatgcagcaagaggaacgtgtgaagatgataactggatgttctgatatgagacggtggatgcgtgtttctgctgattcatcaa |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4109369 |
ttcttcatgacatgacacatgcagcaagaggaacgtgtgaagatgataactggatgttctgatatgagacggtggatgcgtgtttctgctgattcatcaa |
4109270 |
T |
|
| Q |
219 |
cgtctatggataaggaagaggaggagttggaactcatggaca |
260 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4109269 |
cgtctatggataaggaagaggaggagttggaactcatggaca |
4109228 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 47; Significance: 7e-18; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 47; E-Value: 7e-18
Query Start/End: Original strand, 61 - 206
Target Start/End: Original strand, 48154041 - 48154189
Alignment:
| Q |
61 |
gatctcgttgtcgtctaattcgatgacggtgggattaacacctatggtggagagaagcttcttcatgacatgacacatgcagc---aagaggaacgtgtg |
157 |
Q |
| |
|
|||||||||||| || |||| ||| |||||||||| ||| || |||||| |||| || ||| |||||||||| |||||||||| | ||||| || ||| |
|
|
| T |
48154041 |
gatctcgttgtcatccaattggataacggtgggatgaacgccgatggtgaagaggagattcctcatgacatggcacatgcagcatgaggaggatcgggtg |
48154140 |
T |
|
| Q |
158 |
aagatgataactggatgttctgatatgagacggtggatgcgtgtttctg |
206 |
Q |
| |
|
|||||||| || || |||||||||||||| |||| ||| || ||||||| |
|
|
| T |
48154141 |
aagatgatgacagggtgttctgatatgaggcggttgattcgagtttctg |
48154189 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University