View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16114_high_2 (Length: 227)
Name: NF16114_high_2
Description: NF16114
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16114_high_2 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 180; Significance: 2e-97; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 180; E-Value: 2e-97
Query Start/End: Original strand, 1 - 221
Target Start/End: Original strand, 35958010 - 35958240
Alignment:
| Q |
1 |
atataggagggtttttgtacacggctgagtctgagtgtg----------ttccatcgttggtcgtggttgattgcggctgaacccttgaaaccatggacg |
90 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| || ||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35958010 |
atataggagggtttttgtacacggctgagtctgagtctgagtgtgttcgttccatcgttggttgtggttgattgcggctgaacccttgaaaccatggacg |
35958109 |
T |
 |
| Q |
91 |
aagaagcagcaatatcagagcgcaaaactggtcacgttaagaagagagctttaaagaacaaagctttgaccatttctttcgacgagaaagatcccaaaga |
190 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |||||| |
|
|
| T |
35958110 |
aagaagcagcaatatcagagcgcaaaactggtcacgttaagaagagagctttaaagaacaaagctttggccatttctttcgacgagaaagatctcaaaga |
35958209 |
T |
 |
| Q |
191 |
ttatgtcactggctttcacaaacgcaagaag |
221 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
35958210 |
ttatgtcactggctttcacaaacgcaagaag |
35958240 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University