View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16115_high_5 (Length: 244)
Name: NF16115_high_5
Description: NF16115
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16115_high_5 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 80; Significance: 1e-37; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 80; E-Value: 1e-37
Query Start/End: Original strand, 125 - 232
Target Start/End: Original strand, 19788745 - 19788852
Alignment:
| Q |
125 |
tgactgtggccacagggatcccgtttttgccagctctccttaaatttatgaatatcatgtcaggaaagcagaaatggcagtcatgaaccttttaacagtg |
224 |
Q |
| |
|
|||||||||| ||||| ||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
19788745 |
tgactgtggcagcaggggtcctgtttttgccagctctccttaaatttatgaatatcatgtcaggaaagcagaaatggcagtcatgagccttttaacagta |
19788844 |
T |
|
| Q |
225 |
gtaattga |
232 |
Q |
| |
|
| |||||| |
|
|
| T |
19788845 |
gcaattga |
19788852 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 59 - 117
Target Start/End: Original strand, 19788407 - 19788465
Alignment:
| Q |
59 |
gaatcagaacctggaggacccagcccttgattgggctgccactaattctgacacttgct |
117 |
Q |
| |
|
||||||||||||||||||||||||||| ||| ||||||| |||||||||||||||||| |
|
|
| T |
19788407 |
gaatcagaacctggaggacccagccctcaattaggctgccgctaattctgacacttgct |
19788465 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 42; Significance: 0.000000000000006; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 12 - 111
Target Start/End: Original strand, 28172734 - 28172830
Alignment:
| Q |
12 |
atgaaatatccattcgtagaaatgtataaaatacttcaagccatgcagaatcagaacctggaggacccagcccttgattgggctgccactaattctgaca |
111 |
Q |
| |
|
||||||| ||||||| | || |||||| ||||||| |||||||||||||||||||||||||| |||||||| | |||||||| ||||||||||||| |
|
|
| T |
28172734 |
atgaaatctccattcttggagatgtatcaaatactcgaagccatgcagaatcagaacctggag---ccagccctcaactgggctgcgactaattctgaca |
28172830 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University