View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
	Query
	Query hiting target	Query hiting target's complemental strand
	Query's complemental strand hiting target	Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF16115_low_10 (Length: 247)

Name: NF16115_low_10

Description: NF16115

Algorithm: BLASTN 2.2.26 [Sep-21-2011]

Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)

[»] NF16115_low_10

[»] chr4 (2 HSPs)

Target: chr4 (Bit Score: 121; Significance: 4e-62; HSPs: 2)

Name: chr4

Description:

Target: chr4; HSP #1

Raw Score: 121; E-Value: 4e-62

Query Start/End: Original strand, 17 - 180

Target Start/End: Original strand, 54901054 - 54901217

Alignment:

Q	17	atcaaaatgaccgtaagcacatgtctttggatccgtatcatagaagccaaacaaataaagaaatatttagagagaggcaatcagnnnnnnnnnnnnngaa	116	Q
		\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\| \|\|\| \|\|\|
T	54901054	atcaaaatgaccgtaagcacatgtctttggatccgtatcatagaagccaaacaaataaagaaatatttagagagaggcaaccagttttttcttttttgaa	54901153	T

Q	117	tggcaaagtatgaatataaataaataaaggaggaaacaagtcccaaatagataaatatttagag	180	Q
		\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|
T	54901154	tggcaaagtatgaatataaataaataaaggaggaaacaagtcccaaatagataaatatttagag	54901217	T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2

Raw Score: 48; E-Value: 2e-18

Query Start/End: Original strand, 173 - 228

Target Start/End: Original strand, 54902762 - 54902817

Alignment:

Q	173	atttagagagacgcaaccagtgacagtgagtgagaaagtagtttatacataaagat	228	Q
		\|\|\|\|\|\|\|\|\|\|\| \| \|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|
T	54902762	atttagagagaggaaaccagtgacagtgagtgagaaagtagtttatacataaagat	54902817	T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]