View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16115_low_10 (Length: 247)
Name: NF16115_low_10
Description: NF16115
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16115_low_10 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 121; Significance: 4e-62; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 121; E-Value: 4e-62
Query Start/End: Original strand, 17 - 180
Target Start/End: Original strand, 54901054 - 54901217
Alignment:
| Q |
17 |
atcaaaatgaccgtaagcacatgtctttggatccgtatcatagaagccaaacaaataaagaaatatttagagagaggcaatcagnnnnnnnnnnnnngaa |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| ||| |
|
|
| T |
54901054 |
atcaaaatgaccgtaagcacatgtctttggatccgtatcatagaagccaaacaaataaagaaatatttagagagaggcaaccagttttttcttttttgaa |
54901153 |
T |
 |
| Q |
117 |
tggcaaagtatgaatataaataaataaaggaggaaacaagtcccaaatagataaatatttagag |
180 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54901154 |
tggcaaagtatgaatataaataaataaaggaggaaacaagtcccaaatagataaatatttagag |
54901217 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 173 - 228
Target Start/End: Original strand, 54902762 - 54902817
Alignment:
| Q |
173 |
atttagagagacgcaaccagtgacagtgagtgagaaagtagtttatacataaagat |
228 |
Q |
| |
|
||||||||||| | |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54902762 |
atttagagagaggaaaccagtgacagtgagtgagaaagtagtttatacataaagat |
54902817 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University