View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16115_low_5 (Length: 327)
Name: NF16115_low_5
Description: NF16115
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16115_low_5 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 281; Significance: 1e-157; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 281; E-Value: 1e-157
Query Start/End: Original strand, 1 - 314
Target Start/End: Original strand, 39021983 - 39022298
Alignment:
| Q |
1 |
tccgtatcgtttcagccatgtttcatacctcttcttcatgactgcaggattagttgaattctttgtgtgtatttcaggacatgcacttgcagttatccat |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
39021983 |
tccgtatcgtttcagccatgtttcatacctcttcttcatgactgcaggattagttgaattctttgtgtgtatttcaggacatgcacttgcaattatccat |
39022082 |
T |
 |
| Q |
101 |
agattgagtataacaatgcttaatcttatagttgtcttcatggttagtcttagtgcatatggtgaattatagaattagcacaaaattgata--tattgat |
198 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
39022083 |
agattgagtataacaatgcttaatgttatagttgtcttcatggttagtcttagtgcatatggtgaattatagaattagcacaaaattgatatttattgat |
39022182 |
T |
 |
| Q |
199 |
tatcacgaacaacatatagttcttaatgtcttatttatttgtgcattgcaatgcatgctcgtttctgtttagatatacgtttcatttgcatatttatcaa |
298 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
39022183 |
tatcacgaacaacatatagttcttaatgtcttatttatttgtgcattgcaatgcatgctcgtttctgtttagatacgtatttcatttgcatatttatcaa |
39022282 |
T |
 |
| Q |
299 |
ttgtattttcatgtct |
314 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
39022283 |
ttgtattttcatgtct |
39022298 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University