View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16115_low_9 (Length: 250)
Name: NF16115_low_9
Description: NF16115
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16115_low_9 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 215; Significance: 1e-118; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 215; E-Value: 1e-118
Query Start/End: Original strand, 13 - 231
Target Start/End: Original strand, 34341943 - 34342161
Alignment:
| Q |
13 |
aagaatatagcgtttgggagcagtattatcagtatcttcatatccaagaagcttctgattcaacggcacgccttcaaggaaccggttaccggagaagtta |
112 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
34341943 |
aagaatatagcgtttgggagcagtattatcagtatcttcatatccaagaagcttctgattcaatggcacgccttcaaggaaccggttaccggagaagtta |
34342042 |
T |
 |
| Q |
113 |
aagtgtctaagattgcgaaaagaacgaaccgaaactggaactcttcctgtgaagtgattgtctgcaacagaaagagtttccagattgggaaaatacctaa |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34342043 |
aagtgtctaagattgcgaaaagaacgaaccgaaactggaactcttcctgtgaagtgattgtctgcaacagaaagagtttccagattgggaaaatacctaa |
34342142 |
T |
 |
| Q |
213 |
ggaaattcaagtttccaga |
231 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
34342143 |
ggaaattcaagtttccaga |
34342161 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University