View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16117_low_12 (Length: 345)
Name: NF16117_low_12
Description: NF16117
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16117_low_12 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 319; Significance: 1e-180; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 319; E-Value: 1e-180
Query Start/End: Original strand, 1 - 335
Target Start/End: Original strand, 13615441 - 13615775
Alignment:
| Q |
1 |
acagatcttcaccattctctcacaaccccaatggcgtaaaaatccatcctttaacaccttaatcccatctttaaccccaacccatctctcttctctcttc |
100 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
13615441 |
acagatcttcaccattctcttacaaccccaatggcgtaaaaatccatcctttaacaccttaatcccatctttaaccccaactcatctctcttctctcttc |
13615540 |
T |
 |
| Q |
101 |
aacaaccccaatctccaccctctcaccgccctaaacttcttcaaatggatccattaccaacatggtttcatccacaccgttcattcctaccaacctcttc |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13615541 |
aacaaccccaatctccaccctctcaccgccctaaacttcttcaaatggatccattaccaacatggtttcatccacaccgttcattcctaccaacctcttc |
13615640 |
T |
 |
| Q |
201 |
ttttcattcttgttcgaaatgggtttcttcatgctgcagaaaatgtacgaaactcaatgataaagtcttgtgtttcatctcatgaagcaaggtttgtttt |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13615641 |
ttttcattcttgttcgaaatgggtttcttcgtgctgcagagaatgtacgaaactcaatgataaagtcttgtgtttcatctcatgaagcaaggtttgtttt |
13615740 |
T |
 |
| Q |
301 |
gaaccttttgacccatcatgagtttagcctctctg |
335 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
13615741 |
gaaccttttgacccatcatgagtttagcctctctg |
13615775 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University