View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16117_low_14 (Length: 317)
Name: NF16117_low_14
Description: NF16117
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16117_low_14 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 234; Significance: 1e-129; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 234; E-Value: 1e-129
Query Start/End: Original strand, 19 - 308
Target Start/End: Original strand, 7736275 - 7736564
Alignment:
| Q |
19 |
aaaattcattaagtttcggtataagatgcatacctttatttgcagcacactctttaagactcttcttagcatactatttggacggttgaaatttaaatgg |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
7736275 |
aaaattcattaagtttcggtataagatgcatacctttatttgcaacacactctttaagactcttcttagcatactatttggacggttgaaattcaaatgg |
7736374 |
T |
 |
| Q |
119 |
gtcccactaaaacatgactaaaatgtgagtgttttgaagagtgtgttgctgatactcatcgataataacagaatcaaaaagatagttaatttttcttaac |
218 |
Q |
| |
|
|||||| ||||| ||||||||||||||||||||| ||||||||| |||||||||||| |||||||||| |||||||||||||||||||||||||||| | |
|
|
| T |
7736375 |
gtcccattaaaatatgactaaaatgtgagtgtttagaagagtgtattgctgatactcgtcgataataaaggaatcaaaaagatagttaatttttcttatc |
7736474 |
T |
 |
| Q |
219 |
aataaaggatggttattgtttttggtgaaataaaggatgctcaattatcttttgttaattgtagatgatacctgtagctgctgatgatgt |
308 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||| |||||||||||||||||||||||||||||| |||||| ||||||| |
|
|
| T |
7736475 |
aataaaggatggttattgtttttggtgaaatgaaggatgctcaactatcttttgttaattgtagatgatacctgtggctgctaatgatgt |
7736564 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University