View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16117_low_9 (Length: 416)
Name: NF16117_low_9
Description: NF16117
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16117_low_9 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 241; Significance: 1e-133; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 241; E-Value: 1e-133
Query Start/End: Original strand, 99 - 401
Target Start/End: Original strand, 43760060 - 43760380
Alignment:
| Q |
99 |
tgttgttgttttagtatagagtggtggttgttgcagagacagacaagagaagcagtag---------------tagcctagcttgttcttgtttctcggg |
183 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| ||||||||||||||||||||||||||| |
|
|
| T |
43760060 |
tgttgttgttttagtatagagtggtggttgttgcagagacagacaagagaagtagtagtagcagtagttgtagtagcctagcttgttcttgtttctcggg |
43760159 |
T |
|
| Q |
184 |
tcgcgccgctcgtgtttctttgtcgctcctgcgtgcgtgtatgttgttcttcatcttcttctaattgcacttgttgttttttcaatcccaataacctcaa |
283 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||| ||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
43760160 |
tcgcgccgctcgtgtttgtttgtcgctcctgcgtgcgtgtgtgttgttcttcatcttcttctaattgcactttttgttttttcaatcccaataacctcaa |
43760259 |
T |
|
| Q |
284 |
atctcgaggcttgttttgttttctcaaagggtgacacgacacaatctctctttcttcttccgccattttctctcgtgtcttgaaccaggg---tactgcc |
380 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
43760260 |
atctcgaggcttgttttgttttctcaaagggtgacacgacacaatctctctttcttcttccgccattttctctcgtgtcttgaaccagggtactactgcc |
43760359 |
T |
|
| Q |
381 |
agctacaccctcctcttttgc |
401 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
43760360 |
agctacaccctcctcttttgc |
43760380 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 20 - 63
Target Start/End: Original strand, 43759978 - 43760021
Alignment:
| Q |
20 |
ttttggtttttgttatgacacagaaagcgataggtggggattac |
63 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43759978 |
ttttggtttttgttatgacacagaaagcgataggtggggattac |
43760021 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University