View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16118_low_11 (Length: 252)
Name: NF16118_low_11
Description: NF16118
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16118_low_11 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 205; Significance: 1e-112; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 205; E-Value: 1e-112
Query Start/End: Original strand, 19 - 234
Target Start/End: Complemental strand, 4704531 - 4704315
Alignment:
| Q |
19 |
atagctcatagatttccaaggatccttaacccaacaatgtttaggtatagctgctcttatatcaccta-tgtaaaaggtggtggtgcaccagggtcaaaa |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
4704531 |
atagctcatagatttccaaggatccttaacccaacaatgtttaggtatagctgctcttatatcacctaatgtaaaaggtggtggtgcaccagggtcaaaa |
4704432 |
T |
 |
| Q |
118 |
ttaggaaattcctgaactacccctcctccacccttttcttcttcttcctcagcaacccttgaaggagcactcactcttaattcccatgtttttggtttaa |
217 |
Q |
| |
|
|| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4704431 |
tttggaaattcctgaactacccctcctccacccttttcttcttcttcctcagcaacccttgaaggagcactcactcttaattcccatgtttttggtttaa |
4704332 |
T |
 |
| Q |
218 |
accttagatctgaagat |
234 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
4704331 |
accttagatctgaagat |
4704315 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 47 - 116
Target Start/End: Original strand, 25269157 - 25269227
Alignment:
| Q |
47 |
acccaacaatgtttaggtatagctgctcttatatca-cctatgtaaaaggtggtggtgcaccagggtcaaa |
116 |
Q |
| |
|
||||||||||| || || || ||||||||||||||| || ||| ||| |||||||||| |||||||||||| |
|
|
| T |
25269157 |
acccaacaatgctttggaattgctgctcttatatcagccaatgaaaacggtggtggtgaaccagggtcaaa |
25269227 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University