View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16118_low_13 (Length: 204)
Name: NF16118_low_13
Description: NF16118
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16118_low_13 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 141; Significance: 4e-74; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 141; E-Value: 4e-74
Query Start/End: Original strand, 48 - 196
Target Start/End: Original strand, 5202582 - 5202730
Alignment:
| Q |
48 |
tacttcacccgcagctataaagtcattctctatgacctcgtttgcgccggcagtgtcaaccccgattacttcgattaccgccgctacacaactcttgacg |
147 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5202582 |
tacttcacccgcagctataaagtcattctctatgacctcgtttgcgccggcagtgtcaaccccgattacttcgattaccgccgctacacaactcttgacg |
5202681 |
T |
 |
| Q |
148 |
cttacgttgatgacctcctcaacatccttgattcccttcatctcactcg |
196 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||| ||||||| |
|
|
| T |
5202682 |
cttacgttgatgacctcctcaacatccttgattccctccatgtcactcg |
5202730 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University