View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16119_low_2 (Length: 245)
Name: NF16119_low_2
Description: NF16119
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16119_low_2 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 141; Significance: 5e-74; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 141; E-Value: 5e-74
Query Start/End: Original strand, 18 - 216
Target Start/End: Complemental strand, 6840259 - 6840061
Alignment:
| Q |
18 |
gtttatggggtcatgagtatttgcagagcataactcccttgtcaacctagctagctagcatgtgataaactagataaattggttattcaataaacttgnn |
117 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
6840259 |
gtttattgggtcatgagtatttgcagagcataactcccttgtcaacctagctagctagcatgtgataaactagatacattggttattcaataaacttgaa |
6840160 |
T |
 |
| Q |
118 |
nnnnntatgannnnnnngcttatatttgagaatggagggagtaagatatatttatttattttagtcaagtaagtatatgccctctcatacttatgctta |
216 |
Q |
| |
|
||||| |||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
6840159 |
aaaaatatgaattttttgcttatatttgagaatggagggagcaagatatatttatttattttagtcaagtaagtatatgccctgtcatacttatgctta |
6840061 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 18 - 69
Target Start/End: Original strand, 1178640 - 1178691
Alignment:
| Q |
18 |
gtttatggggtcatgagtatttgcagagcataactcccttgtcaacctagct |
69 |
Q |
| |
|
||||||||||| ||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
1178640 |
gtttatggggttctgagtatttacagagcataactcccttgtcaacctagct |
1178691 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University