View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1611_high_21 (Length: 348)
Name: NF1611_high_21
Description: NF1611
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1611_high_21 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 311; Significance: 1e-175; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 311; E-Value: 1e-175
Query Start/End: Original strand, 15 - 337
Target Start/End: Complemental strand, 39775938 - 39775616
Alignment:
| Q |
15 |
attctaactaagcgtgatttatggatcatcgtctgatgcacgaggaggatttgcttgggcgcattgatgacgtaatcacttagcatacacatcctttacg |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39775938 |
attctaactaagcgtgatttatggatcatcgtctgatgcacgaggaggatttgcttgggcgcattgatgacgtaatcacttagcatacacatcctttacg |
39775839 |
T |
 |
| Q |
115 |
taagaaacaaacaaacatcccttgtctggttacgttgttttatacgatagctttgaattggtaagtggaaaaaatcttcgtcattgtcaacaattggtaa |
214 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| ||||||||||| |
|
|
| T |
39775838 |
taagaaacaaacaaaaatcccttgtctggttacgttgttttatacgatagctttgaattggtaagtggaaaatatcttcgtcattgtcgacaattggtaa |
39775739 |
T |
 |
| Q |
215 |
gatgcagactaatcatcagacaagaagattattggtataaatcattttcatgatgatttattcaaaggaactttgttgggttgggtatccaaataatgca |
314 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39775738 |
gatgcagactaatcatcagacaagaagattattggtataaatcattttcatgatgatttattcaaaggaactttgttgggttgggtatccaaataatgca |
39775639 |
T |
 |
| Q |
315 |
gcacaattgcacaaacatttcat |
337 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
39775638 |
gcacaattgcacaaacatttcat |
39775616 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University