View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1611_high_28 (Length: 275)
Name: NF1611_high_28
Description: NF1611
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1611_high_28 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 130; Significance: 2e-67; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 130; E-Value: 2e-67
Query Start/End: Original strand, 2 - 215
Target Start/End: Original strand, 1155277 - 1155492
Alignment:
| Q |
2 |
gataagcgatacaaatatattttagcgaccgaaaatagagaagcgagagagttggtgaagtgagagagacatattttgcgattcaattttgttatcaagt |
101 |
Q |
| |
|
||||||||||| | ||||||||||||||| ||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1155277 |
gataagcgatatagatatattttagcgacggaaaatatagaagcgagagagttggtgaagtgagagagacatattttgcgattcaattttgttatcaagt |
1155376 |
T |
 |
| Q |
102 |
tacagattgaatttcnnnnnnnnnnnnnnnnnacttctacatttaatcatgtggtgttgtagtgatttatgggatgatggtggtgtggtagggatgttgt |
201 |
Q |
| |
|
||||||||||||||| |||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1155377 |
tacagattgaatttcttttttaggtttttattacttctgcatttaatcatgtggtgttgtagtgatttatgggatgatggtggtgtggtagggatgttgt |
1155476 |
T |
 |
| Q |
202 |
--aaaggaaaaaacat |
215 |
Q |
| |
|
||||||||||||| |
|
|
| T |
1155477 |
gagaaggaaaaaacat |
1155492 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University