View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1611_high_32 (Length: 251)
Name: NF1611_high_32
Description: NF1611
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1611_high_32 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 221; Significance: 1e-122; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 221; E-Value: 1e-122
Query Start/End: Original strand, 13 - 237
Target Start/End: Original strand, 34646561 - 34646785
Alignment:
| Q |
13 |
aatattggatttggatcagaataataataaggaggatcaacaaggatattcaacagggatttggactggaatgttgggaggagaaggaggaggatcatgg |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34646561 |
aatattggatttggatcagaataataataaggaggatcaacaaggatattcaacagggatttggactggaatgttgggaggagaaggaggaggatcatgg |
34646660 |
T |
 |
| Q |
113 |
taattaacttgggagaagtcatggatatatttaatacaagtattactactcatttgatttcttctctctatttcaactactagcaaaagttgaattatca |
212 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34646661 |
taattaacttgggagaagtcatgaatatatttaatacaagtattactactcatttgatttcttctctctatttcaactactagcaaaagttgaattatca |
34646760 |
T |
 |
| Q |
213 |
acaagaattagtgatggaaaaaatg |
237 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
34646761 |
acaagaattagtgatggaaaaaatg |
34646785 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University