View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1611_high_35 (Length: 249)
Name: NF1611_high_35
Description: NF1611
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1611_high_35 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 217; Significance: 1e-119; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 217; E-Value: 1e-119
Query Start/End: Original strand, 1 - 233
Target Start/End: Original strand, 4369263 - 4369495
Alignment:
| Q |
1 |
gtgcttgactagaggagcacaagtggagaagctataaccgatcggatgattgtagagaaaatcatctgaagtttgcctagagaatatgatcacgttgttg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4369263 |
gtgcttgactagaggagcacaagtggagaagctataaccgatcggatgattgtagagaaaatcatctgaagtttgcctagagaatatgatcacgttgttg |
4369362 |
T |
 |
| Q |
101 |
cggccattggagagtcaaaaaatttggaggatatgaagagctccaaagctctttggaatcacatgaaaagggtttaggattttacaaaaagatccgcttc |
200 |
Q |
| |
|
||||||||||||||| ||||| ||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4369363 |
cggccattggagagtaaaaaattttggaggatatgaagagctccaaagctctttgaaatcacatgaaaagggtttaggattttacaaaaagatccgcttc |
4369462 |
T |
 |
| Q |
201 |
aagaactggagaccaagccttgcatgtacttat |
233 |
Q |
| |
|
||||||||||||||||||||||| ||||||||| |
|
|
| T |
4369463 |
aagaactggagaccaagccttgcgtgtacttat |
4369495 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University