View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1611_high_48 (Length: 220)
Name: NF1611_high_48
Description: NF1611
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1611_high_48 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 143; Significance: 3e-75; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 143; E-Value: 3e-75
Query Start/End: Original strand, 16 - 206
Target Start/End: Complemental strand, 23013614 - 23013433
Alignment:
| Q |
16 |
ataggtcacgtggtaagtttgaggaccaaatgaatcataagtatatggcatgttctcgtagcaggtcgcgtggaaactatgtccaaaggaatcttaggta |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
23013614 |
ataggtcacgtggtaagtttgaggaccaaatgaatcataagtatatggcatgttctcgtagcaggtcgcgtggaaactatgttcaaaggaatcttaggta |
23013515 |
T |
|
| Q |
116 |
catgtcacgtaatagtttgtttggttgtggcaagcatcaccatgatgctgattttaagtgcaattttgatcatggcaataaggatgatatt |
206 |
Q |
| |
|
|||||| |||||| ||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23013514 |
catgtccagtaata---------gttctggcaagcatcaccatgatgctgattttaagtgcaattttgatcatggcaataaggatgatatt |
23013433 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University