View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1611_low_32 (Length: 292)
Name: NF1611_low_32
Description: NF1611
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1611_low_32 |
 | |
|
| [»] scaffold0531 (1 HSPs) |
| | |
|
Alignment Details
Target: chr6 (Bit Score: 179; Significance: 1e-96; HSPs: 4)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 179; E-Value: 1e-96
Query Start/End: Original strand, 17 - 259
Target Start/End: Complemental strand, 7973082 - 7972840
Alignment:
| Q |
17 |
aaggaagaccaactttcaagtaattctggaaggaatgcaaaatggtggtactctacttttcacaatgtcactgccatggttggagctggtgttcttggtc |
116 |
Q |
| |
|
||||||| |||||| ||||||||||||||||||||||||||||||||||||| ||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7973082 |
aaggaagttcaacttccaagtaattctggaaggaatgcaaaatggtggtactcgactttccacaatgtcactgccatggttggagctggtgttcttggtc |
7972983 |
T |
|
| Q |
117 |
tcccctttgccatggcagctcttggatggtatatttcaaacccaaattacacttaccatgaaatattctgtaaaataaagagaaacagcttagttttgtt |
216 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| ||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
7972982 |
tcccctttgccatggcagctcttggatggtatatttcaaaccctaattacacttaccattaaatattctgtaaaataaagagaaacaaattagttttgtt |
7972883 |
T |
|
| Q |
217 |
atattacnnnnnnnnaaggaaaatatagtattaattatttttg |
259 |
Q |
| |
|
||||||| ||||||||||||||||||||| |||||| |
|
|
| T |
7972882 |
atattactttttttaaaggaaaatatagtattaattttttttg |
7972840 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 147; E-Value: 2e-77
Query Start/End: Original strand, 17 - 195
Target Start/End: Original strand, 8040959 - 8041137
Alignment:
| Q |
17 |
aaggaagaccaactttcaagtaattctggaaggaatgcaaaatggtggtactctacttttcacaatgtcactgccatggttggagctggtgttcttggtc |
116 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||||||| ||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8040959 |
aaggaagaccaacttccaagtaattctggaaggaatgcaaaatggtggtactcgactttccacaatgtcactgccatggttggagctggtgttcttggtc |
8041058 |
T |
|
| Q |
117 |
tcccctttgccatggcagctcttggatggtatatttcaaacccaaattacacttaccatgaaatattctgtaaaataaa |
195 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||| |||||||| ||||||||||||||| ||||||||| |
|
|
| T |
8041059 |
tccccttttccatggcagctcttggatggtatatttcaaaccctaattacacgcaccatgaaatattctctaaaataaa |
8041137 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 100; E-Value: 2e-49
Query Start/End: Original strand, 40 - 195
Target Start/End: Original strand, 8031614 - 8031769
Alignment:
| Q |
40 |
ttctggaaggaatgcaaaatggtggtactctacttttcacaatgtcactgccatggttggagctggtgttcttggtctcccctttgccatggcagctctt |
139 |
Q |
| |
|
||||| ||||||||||||||||||||| ||| |||| |||||||||||||| ||||||||||||||||||||||||||||||||| |||||||| |||| |
|
|
| T |
8031614 |
ttctgaaaggaatgcaaaatggtggtattcttctttccacaatgtcactgcaatggttggagctggtgttcttggtctccccttttccatggcatatctt |
8031713 |
T |
|
| Q |
140 |
ggatggtatatttcaaacccaaattacacttaccatgaaatattctgtaaaataaa |
195 |
Q |
| |
|
|||||||||||||||||||| |||||||||| |||||| |||||| ||| ||||| |
|
|
| T |
8031714 |
ggatggtatatttcaaaccctaattacacttgtcatgaagtattctctaacataaa |
8031769 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #4
Raw Score: 78; E-Value: 2e-36
Query Start/End: Original strand, 46 - 155
Target Start/End: Complemental strand, 7980098 - 7979989
Alignment:
| Q |
46 |
aaggaatgcaaaatggtggtactctacttttcacaatgtcactgccatggttggagctggtgttcttggtctcccctttgccatggcagctcttggatgg |
145 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| ||||||||| |
|
|
| T |
7980098 |
aaggaatgcaaaatggtggtactcagcttttcacaatgtcactgccatggttggagctggtgttcttggtctccctcatgccatggcacaacttggatgg |
7979999 |
T |
|
| Q |
146 |
tatatttcaa |
155 |
Q |
| |
|
|||||||||| |
|
|
| T |
7979998 |
tatatttcaa |
7979989 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 118; Significance: 3e-60; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 118; E-Value: 3e-60
Query Start/End: Original strand, 41 - 195
Target Start/End: Complemental strand, 41383084 - 41382928
Alignment:
| Q |
41 |
tctggaaggaatgcaaaatggtggtactctacttttcacaatgtcactgccatggttggagctggtgttcttggtctcccctttgccatggcagctcttg |
140 |
Q |
| |
|
|||| ||| |||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |||| |
|
|
| T |
41383084 |
tctgaaagaaatgcaaaatggtggtactctactttccacaatgtcactgccatggttggagctggtgttcttggtctccccttttccatggcagcccttg |
41382985 |
T |
|
| Q |
141 |
gatggtatatttcaaacccaaattacacttaccatg--aaatattctgtaaaataaa |
195 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||| ||||||||| ||||||||| |
|
|
| T |
41382984 |
gatggtatattttaaacccaaattacacttaccatgaaaaatattctctaaaataaa |
41382928 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 46 - 149
Target Start/End: Original strand, 43851784 - 43851887
Alignment:
| Q |
46 |
aaggaatgcaaaatggtggtactctacttttcacaatgtcactgccatggttggagctggtgttcttg-gtctcccctttgccatggcagctcttggatg |
144 |
Q |
| |
|
|||||||||||||||||||||| | ||||||||||||| |||||||||||||||||||||| ||||| |||| || | |||||||||| ||||||||| |
|
|
| T |
43851784 |
aaggaatgcaaaatggtggtacgcagcttttcacaatgttactgccatggttggagctggtg-tcttgagtcttccatctgccatggcaagtcttggatg |
43851882 |
T |
|
| Q |
145 |
gtata |
149 |
Q |
| |
|
||||| |
|
|
| T |
43851883 |
gtata |
43851887 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0531 (Bit Score: 102; Significance: 1e-50; HSPs: 1)
Name: scaffold0531
Description:
Target: scaffold0531; HSP #1
Raw Score: 102; E-Value: 1e-50
Query Start/End: Original strand, 46 - 195
Target Start/End: Complemental strand, 4046 - 3898
Alignment:
| Q |
46 |
aaggaatgcaaaatggtggtactctacttttcacaatgtcactgccatggttggagctggtgttcttggtctcccctttgccatggcagctcttggatgg |
145 |
Q |
| |
|
||||||||||||||||||||| ||| |||| |||||||||||||| ||||||||||||||||||||||| ||||||| | |||||||||||||||||||| |
|
|
| T |
4046 |
aaggaatgcaaaatggtggtattcttctttccacaatgtcactgcaatggttggagctggtgttcttggcctcccctattccatggcagctcttggatgg |
3947 |
T |
|
| Q |
146 |
tatatttcaaacccaaattacacttaccatgaaatattctgtaaaataaa |
195 |
Q |
| |
|
|||| ||||||||| ||||||||||||||||||||| ||| ||||||||| |
|
|
| T |
3946 |
tata-ttcaaaccctaattacacttaccatgaaatagtctctaaaataaa |
3898 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 55; Significance: 1e-22; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 50 - 152
Target Start/End: Complemental strand, 14199215 - 14199113
Alignment:
| Q |
50 |
aatgcaaaatggtggtactctacttttcacaatgtcactgccatggttggagctggtgttcttggtctcccctttgccatggcagctcttggatggtata |
149 |
Q |
| |
|
||||||||||||||||| ||| | || |||||||| ||||||||||||||||||||||||||| ||||||| | ||||||||| ||||||||||||| |
|
|
| T |
14199215 |
aatgcaaaatggtggtattctgcattccacaatgttactgccatggttggagctggtgttcttagtctcccttatgccatggctcaacttggatggtata |
14199116 |
T |
|
| Q |
150 |
ttt |
152 |
Q |
| |
|
||| |
|
|
| T |
14199115 |
ttt |
14199113 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 33; Significance: 0.000000002; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 47 - 99
Target Start/End: Original strand, 34408914 - 34408966
Alignment:
| Q |
47 |
aggaatgcaaaatggtggtactctacttttcacaatgtcactgccatggttgg |
99 |
Q |
| |
|
||||| || ||||||||||||||| ||||||||||| |||| ||||||||||| |
|
|
| T |
34408914 |
aggaaagccaaatggtggtactctgcttttcacaatatcacggccatggttgg |
34408966 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 32; Significance: 0.000000006; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 53 - 108
Target Start/End: Complemental strand, 361842 - 361787
Alignment:
| Q |
53 |
gcaaaatggtggtactctacttttcacaatgtcactgccatggttggagctggtgt |
108 |
Q |
| |
|
|||||||||||||| || |||||||| ||||| ||||| |||||||| |||||||| |
|
|
| T |
361842 |
gcaaaatggtggtattcaacttttcataatgtgactgctatggttggtgctggtgt |
361787 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 65 - 114
Target Start/End: Complemental strand, 42986823 - 42986774
Alignment:
| Q |
65 |
tactctacttttcacaatgtcactgccatggttggagctggtgttcttgg |
114 |
Q |
| |
|
|||||| | ||||| ||||||||||||||||||||||||| |||||||| |
|
|
| T |
42986823 |
tactctgcgtttcataatgtcactgccatggttggagctgcagttcttgg |
42986774 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University