View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1611_low_53 (Length: 227)
Name: NF1611_low_53
Description: NF1611
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1611_low_53 |
 | |
|
| [»] chr7 (1 HSPs) |
| |
|
Alignment Details
Target: chr7 (Bit Score: 208; Significance: 1e-114; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 208; E-Value: 1e-114
Query Start/End: Original strand, 2 - 227
Target Start/End: Complemental strand, 47528792 - 47528570
Alignment:
| Q |
2 |
aatgagcatgtcagatcattgcaaatacacataaatcaattggaaatggattccttctagttggaatatcgctggattcacgcaatcagtgcaatggcta |
101 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47528792 |
aatgagcatgtcagatcattgcaaatacacataaatcaattggaaatggattccttctagttggaatatcgctggattcacgcaatcagtgcaatggcta |
47528693 |
T |
|
| Q |
102 |
ctactggattcagatcggacatttcacaaaataagaagattctgattcttcttgaaaatccaaagcaccgaggttgaatatcaagcatccgatcttaatc |
201 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
47528692 |
ctactggattcagatcggacatttcacaaaataagaagattctgattcttcttgaaaatccaaagcaccgaggttgaatctcaagcatccgatcttaatc |
47528593 |
T |
|
| Q |
202 |
taagtagtagacaccaatgtgctgac |
227 |
Q |
| |
|
|||||||| ||||||||||||||| |
|
|
| T |
47528592 |
taagtagt---caccaatgtgctgac |
47528570 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University