View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1611_low_55 (Length: 217)
Name: NF1611_low_55
Description: NF1611
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1611_low_55 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 181; Significance: 6e-98; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 181; E-Value: 6e-98
Query Start/End: Original strand, 15 - 199
Target Start/End: Complemental strand, 29068968 - 29068784
Alignment:
| Q |
15 |
cacagatctgaccacgcacaaagagagtctcactgagagcagcagcaccggtgatgccataaccgtctctgtgagtgtcaccatagccgcacgccccgtc |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
29068968 |
cacagatctgaccacgcacaaagagagtctcactgagagcagcagcaccggtgatgccataaccgtctctgtgagtgtcaccgtagccgcacgccccgtc |
29068869 |
T |
|
| Q |
115 |
tactccgtctctggtgtcatcagagacggagtagtaagtggcgtgggcggacagccattcggagtaagtggaagagggagatgta |
199 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29068868 |
tactccgtctctggtgtcatcagagacggagtagtaagtggcgtgggcggacagccattcggagtaagtggaagagggagatgta |
29068784 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University