View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16120_high_14 (Length: 322)
Name: NF16120_high_14
Description: NF16120
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16120_high_14 |
 |  |
|
| [»] scaffold0194 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr8 (Bit Score: 261; Significance: 1e-145; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 261; E-Value: 1e-145
Query Start/End: Original strand, 11 - 306
Target Start/End: Complemental strand, 33144931 - 33144636
Alignment:
| Q |
11 |
agaatatgcatcaagtggaaaattgacagagaaatctgatgttttttcatttggggttatgctattagaactcttaactggaaaaagacctttggattta |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33144931 |
agaatatgcatcaagtggaaaattgacagagaaatctgatgttttttcatttggggttatgctattagaactcttaactggaaaaagacctttggattta |
33144832 |
T |
 |
| Q |
111 |
accaatgccatggacgaaagcttagttgattgggttagtactatactattctatctttcatcgatcgnnnnnnnnnttagtataaaaattaatatgaagt |
210 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
33144831 |
accaatgccatggacgaaagcttagttgattgggttagtactatactattctatctttcatcgatcgataaaaaaattagtataaaaattaatatgaagt |
33144732 |
T |
 |
| Q |
211 |
ttgtgtactgggcaggctcgaccacttttgagtcatgcattggaggaggatggaaactttgcagaattggtggatccatttttggaaggaaattac |
306 |
Q |
| |
|
||||||||||| |||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33144731 |
ttgtgtactggacaggctcgaccacttttgagtcgtgcattggaggaggatggaaactttgcagaattggtggatccatttttggaaggaaattac |
33144636 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 48; Significance: 2e-18; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 12 - 91
Target Start/End: Original strand, 7564516 - 7564595
Alignment:
| Q |
12 |
gaatatgcatcaagtggaaaattgacagagaaatctgatgttttttcatttggggttatgctattagaactcttaactgg |
91 |
Q |
| |
|
|||||||||||||||||||||||||||||||| || || ||||| ||||||||||| |||||||| ||||| ||||||| |
|
|
| T |
7564516 |
gaatatgcatcaagtggaaaattgacagagaagtccgacgttttctcatttggggtcatgctattggaacttgtaactgg |
7564595 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 222 - 302
Target Start/End: Original strand, 7564733 - 7564813
Alignment:
| Q |
222 |
gcaggctcgaccacttttgagtcatgcattggaggaggatggaaactttgcagaattggtggatccatttttggaaggaaa |
302 |
Q |
| |
|
||||||||||||||| |||| || || | | |||||||||||||||||| || |||||||||||||||||||||||||| |
|
|
| T |
7564733 |
gcaggctcgaccactattgactcgtggactcgaggaggatggaaactttagcgagttggtggatccatttttggaaggaaa |
7564813 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0194 (Bit Score: 32; Significance: 0.000000007; HSPs: 1)
Name: scaffold0194
Description:
Target: scaffold0194; HSP #1
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 12 - 83
Target Start/End: Complemental strand, 14725 - 14654
Alignment:
| Q |
12 |
gaatatgcatcaagtggaaaattgacagagaaatctgatgttttttcatttggggttatgctattagaactc |
83 |
Q |
| |
|
|||||||||||||||||||||||||| || || |||||||| | ||| ||||| ||| |||| || |||||| |
|
|
| T |
14725 |
gaatatgcatcaagtggaaaattgactgacaagtctgatgtatattcttttggagttgtgcttttggaactc |
14654 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University