View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16120_low_20 (Length: 295)
Name: NF16120_low_20
Description: NF16120
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16120_low_20 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 191; Significance: 1e-104; HSPs: 3)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 191; E-Value: 1e-104
Query Start/End: Original strand, 12 - 230
Target Start/End: Original strand, 33492030 - 33492247
Alignment:
| Q |
12 |
atgaagcaaaaactgagataggttaaaaattagaaactagtatgacatgaatcagaaactggtatgtcagcaagataccatgtattcattttgtcgtatg |
111 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |||| |
|
|
| T |
33492030 |
atgaagcagaaactgagataggttaaaaattagaaactagtatgacatgaatcagaaactggtatgttagcaagataccatgtattcattttgtc-tatg |
33492128 |
T |
 |
| Q |
112 |
atgtcattttggtatgtcagttgggtttcatcaaggctctctcaaacctttaataacggagaattactgtcaaccgaagccggaactctagctcgagcaa |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |||||||||||| |||||||||||| |
|
|
| T |
33492129 |
atgtcattttggtatgtcagttgggtttcatcaaggctctctcaaacctttaataatggagaattactgtcaactgaagccggaactttagctcgagcaa |
33492228 |
T |
 |
| Q |
212 |
ttgcatatggtacaataaa |
230 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
33492229 |
ttgcatatggtacaataaa |
33492247 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 164 - 239
Target Start/End: Complemental strand, 28809513 - 28809438
Alignment:
| Q |
164 |
ataacggagaattactgtcaaccgaagccggaactctagctcgagcaattgcatatggtacaataaaaatttcagg |
239 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||||| ||||||| |||||||||||| ||||||||| |
|
|
| T |
28809513 |
ataacggaggattactgtcaaccgaagccggaactctagctcgagtaattgcagatggtacaataacaatttcagg |
28809438 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 58 - 105
Target Start/End: Complemental strand, 28811349 - 28811302
Alignment:
| Q |
58 |
atgaatcagaaactggtatgtcagcaagataccatgtattcattttgt |
105 |
Q |
| |
|
||||| |||||||||||||||||||||| | ||||||||||||||||| |
|
|
| T |
28811349 |
atgaagcagaaactggtatgtcagcaaggttccatgtattcattttgt |
28811302 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University