View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16120_low_27 (Length: 250)
Name: NF16120_low_27
Description: NF16120
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16120_low_27 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 239; Significance: 1e-132; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 239; E-Value: 1e-132
Query Start/End: Original strand, 1 - 243
Target Start/End: Original strand, 27054238 - 27054480
Alignment:
| Q |
1 |
taccctctgtccaagttgatttcacagcaggaactaaaattctatcatacatggaagctactaggtaacaagtactttgaaaaagcaacgtctaattttc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27054238 |
taccctctgtccaagttgatttcacagcaggaactaaaattctatcatacatggaagctactaggtaacaagtactttgaaaaagcaacgtctaattttc |
27054337 |
T |
|
| Q |
101 |
cttgttcttagtctacaaaatattgaataattcagttttatttttatgatattcttgcttgttataggaatcctgtaatcaagtttagcaagaccagaac |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27054338 |
cttgttcttagtctacaaaatattgaataattcagttttatttttatgatattcttgcttgttataggaatcctgtaatcaagtttagcaagaccagaac |
27054437 |
T |
|
| Q |
201 |
agttgtgggacaacagatgtcccccgatgtggcattcttctct |
243 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
27054438 |
agttgtgggacaacagatgtcccccgatgtggcattattctct |
27054480 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University