View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16120_low_29 (Length: 247)
Name: NF16120_low_29
Description: NF16120
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16120_low_29 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 104; Significance: 6e-52; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 104; E-Value: 6e-52
Query Start/End: Original strand, 125 - 228
Target Start/End: Original strand, 35723414 - 35723517
Alignment:
| Q |
125 |
gtgaaattcgattgaattacccgacttgaaatggatcaaaggtaccatgaacagcaaaatcagcaacaccgtttgaagaagactgcaatctacgatgcct |
224 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35723414 |
gtgaaattcgattgaattacccgacttgaaatggatcaaaggtaccatgaacagcaaaatcagcaacaccgtttgaagaagactgcaatctacgatgcct |
35723513 |
T |
 |
| Q |
225 |
taac |
228 |
Q |
| |
|
|||| |
|
|
| T |
35723514 |
taac |
35723517 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University