View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16120_low_32 (Length: 241)
Name: NF16120_low_32
Description: NF16120
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16120_low_32 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 176; Significance: 6e-95; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 176; E-Value: 6e-95
Query Start/End: Original strand, 17 - 230
Target Start/End: Complemental strand, 36995384 - 36995167
Alignment:
| Q |
17 |
attgttatataaatttttatgaaaacctactacttaagatgnnnnnnnagaaactatttaaaatggaagag----agtaccaaatacatccgataacact |
112 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
36995384 |
attgttatataaatttttatgaaaacctactacttaagatgtttttttagaaactatttaaaatggaagagctagagtaccaaatacatccgataacact |
36995285 |
T |
 |
| Q |
113 |
tcccaactttaattaaaatacttaatacctaagtttacctaatttacatcttaaacctctacctcgtgtcaagttactaaccaacaagagacatcgagca |
212 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
36995284 |
tcccaactttaattaaaatacttaatacctaagtttacctaatttacatcttaaacctctacctcgtgtcaagttactatccaacaagagacatcgagca |
36995185 |
T |
 |
| Q |
213 |
tacacgtgtaaaagtatt |
230 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
36995184 |
tacacgtgtaaaagtatt |
36995167 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University