View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16120_low_33 (Length: 225)
Name: NF16120_low_33
Description: NF16120
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16120_low_33 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 184; Significance: 1e-99; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 184; E-Value: 1e-99
Query Start/End: Original strand, 19 - 210
Target Start/End: Original strand, 36151449 - 36151640
Alignment:
| Q |
19 |
gatagggtacttatgcctcttgatcttgttcttccggctaaggctccagctctggctcctgcaccagctaagggtttgttgcctaaggctggaaaaacga |
118 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36151449 |
gataaggtacttatgcctcttgatcttgttcttccggctaaggctccagctctggctcctgcaccagctaagggtttgttgcctaaggctggaaaaacga |
36151548 |
T |
|
| Q |
119 |
attcttcagttgcagatgatggtagtggtgctggtagtgatgatggtgatggcaaggatttacctgctgatgtttctgctgcagggtctgtg |
210 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
36151549 |
attcttcagttgcagatgatggtagtggtgctggtagtgatgatggtgatggcaaggatttacctgctgatatttctgctgcagggtctgtg |
36151640 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 184; E-Value: 1e-99
Query Start/End: Original strand, 19 - 210
Target Start/End: Original strand, 36154835 - 36155026
Alignment:
| Q |
19 |
gatagggtacttatgcctcttgatcttgttcttccggctaaggctccagctctggctcctgcaccagctaagggtttgttgcctaaggctggaaaaacga |
118 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36154835 |
gataaggtacttatgcctcttgatcttgttcttccggctaaggctccagctctggctcctgcaccagctaagggtttgttgcctaaggctggaaaaacga |
36154934 |
T |
|
| Q |
119 |
attcttcagttgcagatgatggtagtggtgctggtagtgatgatggtgatggcaaggatttacctgctgatgtttctgctgcagggtctgtg |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36154935 |
attcttcagttgcagatgatggtagtggtgctggtagtgatgatggtgatggtaaggatttacctgctgatgtttctgctgcagggtctgtg |
36155026 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University