View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16120_low_7 (Length: 421)
Name: NF16120_low_7
Description: NF16120
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16120_low_7 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 316; Significance: 1e-178; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 316; E-Value: 1e-178
Query Start/End: Original strand, 20 - 378
Target Start/End: Original strand, 26513179 - 26513537
Alignment:
| Q |
20 |
acaagcagcatatgatctcattagtttgattcctagagatggattttgatgtgaattaagataaaaagtcatggtgtgaagctttttcaaggttttgata |
119 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| ||||||||| |
|
|
| T |
26513179 |
acaagcagcatatgatctcattagtttgattcctagagatggattttgatgtgaattaagataaaaaatcatggtgtgaagctttttcaaagttttgata |
26513278 |
T |
 |
| Q |
120 |
tctgggttttggtctagtgcttttgctagaagttccaaagcttgtgaggatttgttgaatgaagaaagtaatgcttgtaattcagaaatgtgacgagata |
219 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26513279 |
tctgggttttggtctagtgcttttgctagaagt-ccaaagcttgtgaggatttgttgaatgaagaaagtaatgcttgtaattcagaaatgtgacgagata |
26513377 |
T |
 |
| Q |
220 |
gtttatgaaatggtagcattttacatatatctctgtcaatcgtgaataacaatattttcgtagtatatagtagagggaaatacaccatgcatatagttaa |
319 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||| ||||||||||||||||||||||||||||| ||||||||||||||||| | |
|
|
| T |
26513378 |
gtttatgaaatggtagcattttacatatatctctgtcaatcatgaataacgatattttcgtagtatatagtagagggaaaaacaccatgcatatagttga |
26513477 |
T |
 |
| Q |
320 |
ata-tcaggtatgaagagaatataataaggtactgtaagtctttcgatccaatggtgaat |
378 |
Q |
| |
|
||| ||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
26513478 |
atattcaggtatgaagagaatataataaggtactgtaagactttcgatccaatggtgaat |
26513537 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University