View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16120_low_9 (Length: 376)
Name: NF16120_low_9
Description: NF16120
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16120_low_9 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 335; Significance: 0; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 335; E-Value: 0
Query Start/End: Original strand, 18 - 368
Target Start/End: Original strand, 46974594 - 46974944
Alignment:
| Q |
18 |
attatcctctttgacgctgctctcacatgccatatttcatattgttttggccattgagggggatcagtggagtaccgccgatgctcagtgggctcagcta |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46974594 |
attatcctctttgacgctgctctcacatgccatatttcatattgttttggccatcgagggggatcagtggagtaccgccgatgctcagtgggctcagcta |
46974693 |
T |
|
| Q |
118 |
attggatttataaggttttgttttggttttaaattttgtttattataactccctccacagtgtatcaccatttagagtatactacaaatactgtattaaa |
217 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
46974694 |
attggatttataaggttttgttttggttttaaattttgtttattataactccctccacagtgtatcaccatttagagtatactgcaaatactgtattaaa |
46974793 |
T |
|
| Q |
218 |
tgattttgcagagtgcagtcttggagaacattgcctgtagagtattttttggttatgcaagtactagcaacctttctttctctaattgaaatatatggaa |
317 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46974794 |
tgattttgcagagtgcagtcttggagaacattgcctatagagtattttttggttatgcaagtactagcaacctttctttctctaattgaaatatatggaa |
46974893 |
T |
|
| Q |
318 |
atggacttggtcaagatgcatggggaaatttttattcagggtacctatgct |
368 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46974894 |
atggacgtggtcaagatgcatggggaaatttttattcagggtacctatgct |
46974944 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University