View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16121_high_8 (Length: 284)
Name: NF16121_high_8
Description: NF16121
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16121_high_8 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 227; Significance: 1e-125; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 227; E-Value: 1e-125
Query Start/End: Original strand, 19 - 269
Target Start/End: Original strand, 39291219 - 39291468
Alignment:
| Q |
19 |
attatggacacattgcgcagagggagtaaaccttggaaggggtgcaattgctttgatacgcgcattggtaccattcggagtagttacagaggataaacgt |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
39291219 |
attatggacacattgcgcagagggagtaaaccttggaaggggtgcaatcgctttgatacgcgcattggtaccattcgaagtagttacagaggataaacgt |
39291318 |
T |
 |
| Q |
119 |
aatcataacataatccaaaacgtttcaaatctttacgaagttaacaataactgcttggtttgctcgaatacgtttcgtttcttatatttattctgatcta |
218 |
Q |
| |
|
||||||||||||||||||| |||||||||||||| ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39291319 |
aatcataacataatccaaa-cgtttcaaatctttgcgaagttaacaataacttcttggtttgctcgaatacgtttcgtttcttatatttattctgatcta |
39291417 |
T |
 |
| Q |
219 |
aaaggtcaatttcaaaaatcatttgaaaagtaacatttaggggcaccagtt |
269 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39291418 |
aaaggtcaatttcaaaaatcatttgaaaagtaacatttaggggcaccagtt |
39291468 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University