View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF16122_low_13 (Length: 236)

Name: NF16122_low_13
Description: NF16122
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF16122_low_13
NF16122_low_13
[»] chr6 (1 HSPs)
chr6 (1-222)||(3601737-3601960)
[»] chr7 (1 HSPs)
chr7 (18-74)||(4175327-4175383)


Alignment Details
Target: chr6 (Bit Score: 185; Significance: 1e-100; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 185; E-Value: 1e-100
Query Start/End: Original strand, 1 - 222
Target Start/End: Complemental strand, 3601960 - 3601737
Alignment:
1 ttatccaaaaaatcgttaatgttggaaattgactcaaaattgatattgaagttctgaaaaaatcgtggcgtgattaaaaatccaaactttcttataaaat 100  Q
    |||||||||||||||||||||||| ||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||    
3601960 ttatccaaaaaatcgttaatgttgaaaattgattcaaaattgatattgaagttctgaaaaaatcgtggcgtgattaaaaatccaaacttttttataaaat 3601861  T
101 aatattgtgtc--tttcttttataaatgacgataaatgagataaaataaatgaaacaaaactgttaatgcaatgttcatctgcacaatatatataattaa 198  Q
    |||||||||||  | ||||||||||||||||||||||| |||||| ||||||||||||||| ||||||||||||||||||||||||||||||||||||||    
3601860 aatattgtgtctatatcttttataaatgacgataaatgggataaagtaaatgaaacaaaaccgttaatgcaatgttcatctgcacaatatatataattaa 3601761  T
199 aaaacattataaaaccttgtttct 222  Q
    ||||||||||||||||||||||||    
3601760 aaaacattataaaaccttgtttct 3601737  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 18 - 74
Target Start/End: Complemental strand, 4175383 - 4175327
Alignment:
18 aatgttggaaattgactcaaaattgatattgaagttctgaaaaaatcgtggcgtgat 74  Q
    |||||||  |||||||||||||||||| |||||||||  ||||||| |||| |||||    
4175383 aatgttgataattgactcaaaattgatgttgaagttcataaaaaattgtggggtgat 4175327  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University