View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16122_low_17 (Length: 204)
Name: NF16122_low_17
Description: NF16122
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16122_low_17 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 94; Significance: 4e-46; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 94; E-Value: 4e-46
Query Start/End: Original strand, 17 - 186
Target Start/End: Original strand, 31609179 - 31609338
Alignment:
| Q |
17 |
atcactttcattttgccttatgtcatttatataccatgccttgttagttctcgacatttgccttgcatagccataactcattattcttaagtatagtaac |
116 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |||||||||||||| |
|
|
| T |
31609179 |
atcactttcattttgccttatgtcatttatataccatgccttgttagttctcgacatttgccttgcataaccataactcattatttttaagtatagtaac |
31609278 |
T |
 |
| Q |
117 |
nnnnnnnnnnnnnnnngaagaagaagaatcgattaaggctctcaaagagtcatagcttgtgtgtctcatc |
186 |
Q |
| |
|
| || ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31609279 |
aaaaaaa----------ataaaaaagaatcgattaaggctctcaaagagtcatagcttgtgtgtctcatc |
31609338 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University