View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16123_high_32 (Length: 333)
Name: NF16123_high_32
Description: NF16123
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16123_high_32 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 162; Significance: 2e-86; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 162; E-Value: 2e-86
Query Start/End: Original strand, 103 - 316
Target Start/End: Complemental strand, 13629457 - 13629253
Alignment:
| Q |
103 |
gtttaacagtgtggtaactaataagtatccgaaatatgttggtttagtaaccaaggtataggcttctgctatatagttcagtatgagaaagcatacatct |
202 |
Q |
| |
|
|||||| |||||||||||||||||||||| |||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13629457 |
gtttaatagtgtggtaactaataagtatctgaaatatgttggtttaataaccaaggtataggcttctgctatatagttcagtatgagaaagcatacatct |
13629358 |
T |
|
| Q |
203 |
tgaatggaatgaataatagacgcaactatttattgtgttaaggggaatataattttgactcagatgttctggctttatgtattagtctttaggcagcctt |
302 |
Q |
| |
|
||||| ||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
13629357 |
tgaat---------aatagacgcaactatttattgtgttgaggggaatataattttgactcagatgttctggctttatgtattagtctttaggcaacctt |
13629267 |
T |
|
| Q |
303 |
gtcactgaccttaa |
316 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
13629266 |
gtcactgaccttaa |
13629253 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University