View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16123_high_34 (Length: 319)
Name: NF16123_high_34
Description: NF16123
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16123_high_34 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 213; Significance: 1e-117; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 213; E-Value: 1e-117
Query Start/End: Original strand, 20 - 309
Target Start/End: Original strand, 7165640 - 7165926
Alignment:
| Q |
20 |
caatcaaccatttgttttacttctcaaccaccattatcaccaaaattttaattcacttttatccttttcgtcgtgtcacaatcgttaatactatataaag |
119 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
7165640 |
caatcaaccatttgttttacttctcaaccaccattatcaccaaaattttaattcacttttatcattttcgtcgtgtcacaatcgttaatactatataaag |
7165739 |
T |
|
| Q |
120 |
cttttgtcaaaaaactataactaaaaattatttatggtcaaatgtgatcaataccatctcaatctcatttacgtagatatttaaaacttagatatcttta |
219 |
Q |
| |
|
|||||||||||||||||||||| |||| ||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
7165740 |
cttttgtcaaaaaactataactgaaaa----ttatggtcagatgtgatcaataccatctcaatctcatttacgtagatatttaaaacttagatatctata |
7165835 |
T |
|
| Q |
220 |
gcttgtcattaacccttt-nnnnnnntagttgtgacatccatgtcatcaccatctttaccacctaggtacctattccctgttcttctcact |
309 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||| |||||||||||||||||| |||| ||| ||||| |
|
|
| T |
7165836 |
gcttgtcattaaccctttaaaaaaaatagttgtgacatccatgtcatcaccatctttgccacctaggtacctattcactgtccttatcact |
7165926 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University