View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16123_high_37 (Length: 308)
Name: NF16123_high_37
Description: NF16123
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16123_high_37 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 131; Significance: 6e-68; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 131; E-Value: 6e-68
Query Start/End: Original strand, 1 - 151
Target Start/End: Complemental strand, 41864840 - 41864690
Alignment:
| Q |
1 |
taaagtggaatcaaatgaagttgaatggcggggctaaggagcacaaaaaagagtgggtttgaataatttgtttacgaagaaacacaagcttggagccacc |
100 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||||||||||||||| ||| ||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
41864840 |
taaagtggaaacaaatgaagttgaatggcggggctaaggagcacaaaaaagagaggggctgaataatttgtttacgaagaaacacaagcttggaaccacc |
41864741 |
T |
 |
| Q |
101 |
aacttgaaccatccccttttggaagcaatatagttgagttcatttattgag |
151 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41864740 |
aacttgaaccatccccttttggaagcaatatagttgagttcatttattgag |
41864690 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 97; E-Value: 1e-47
Query Start/End: Original strand, 190 - 294
Target Start/End: Complemental strand, 41864624 - 41864520
Alignment:
| Q |
190 |
ataaagaacccttcgtatgaatgttaactcttcatatctgtgtgctttctctttgcatcggtttgttttgttttctcaagaattttctccttacatgttt |
289 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41864624 |
ataaagaacccttcgtatgaatgttaactcttcatatctgtgtgctttctgtttgtatcggtttgttttgttttctcaagaattttctccttacatgttt |
41864525 |
T |
 |
| Q |
290 |
tacat |
294 |
Q |
| |
|
||||| |
|
|
| T |
41864524 |
tacat |
41864520 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 35; Significance: 0.0000000001; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 1 - 35
Target Start/End: Original strand, 26451953 - 26451987
Alignment:
| Q |
1 |
taaagtggaatcaaatgaagttgaatggcggggct |
35 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
26451953 |
taaagtggaatcaaatgaagttgaatggcggggct |
26451987 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University