View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16123_high_59 (Length: 250)
Name: NF16123_high_59
Description: NF16123
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16123_high_59 |
 | |
|
| [»] chr8 (1 HSPs) |
| |
|
Alignment Details
Target: chr8 (Bit Score: 129; Significance: 7e-67; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 129; E-Value: 7e-67
Query Start/End: Original strand, 122 - 250
Target Start/End: Complemental strand, 21362953 - 21362825
Alignment:
| Q |
122 |
gtgccaccccatgttcaaattttcattataacgtaacatttcttaaattagagagagaataagaccttgagctgctgaattttctgcgtcattgttctcc |
221 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21362953 |
gtgccaccccatgttcaaattttcattataacgtaacatttcttaaattagagagagaataagaccttgagctgctgaattttctgcgtcattgttctcc |
21362854 |
T |
|
| Q |
222 |
tcttttttcaaaaagcagataaaagcttt |
250 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
21362853 |
tcttttttcaaaaagcagataaaagcttt |
21362825 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University