View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16123_high_63 (Length: 243)
Name: NF16123_high_63
Description: NF16123
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16123_high_63 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 82; Significance: 8e-39; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 82; E-Value: 8e-39
Query Start/End: Original strand, 19 - 104
Target Start/End: Original strand, 30667430 - 30667515
Alignment:
| Q |
19 |
atatcatggtctaaggtagggtaaagtggtcatggaattggtgtaatgttctaatttctcttcccctctgattttctcggaattcc |
104 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30667430 |
atatcatggtctaaggtagggtaaagttgtcatggaattggtgtaatgttctaatttctcttcccctctgattttctcggaattcc |
30667515 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 57; E-Value: 6e-24
Query Start/End: Original strand, 168 - 224
Target Start/End: Original strand, 30667579 - 30667635
Alignment:
| Q |
168 |
attgtactaccttctagtctatctactataagttgagaattatgctttacaattgat |
224 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30667579 |
attgtactaccttctagtctatctactataagttgagaattatgctttacaattgat |
30667635 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University