View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16123_high_71 (Length: 203)
Name: NF16123_high_71
Description: NF16123
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16123_high_71 |
 | |
|
| [»] chr8 (1 HSPs) |
| |
|
Alignment Details
Target: chr8 (Bit Score: 148; Significance: 3e-78; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 148; E-Value: 3e-78
Query Start/End: Original strand, 1 - 203
Target Start/End: Original strand, 21362642 - 21362844
Alignment:
| Q |
1 |
tttccatttcatttcatatctctctatcgtcgcttctggtttctctctcctctagggttnnnnnnnnnnnnnnnnnggaggagaaggaccaatctccaag |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
21362642 |
tttccatttcatttcatatctctctatcgtcgcttctggtttctctctcctctagggtttcatcatcatcatcatcggaggagaaggaccaatctccaag |
21362741 |
T |
|
| Q |
101 |
cttcgaattcgtttcgatattcgtcaattcgaagcttaaattttggttcttctccgtttaatttcggtctctcttcaatgtaaaaagcttttatctgctt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
21362742 |
cttcgaattcgtttcgatattcgtcaattcgaagcttaaattttggttcttctccgtttaatttgggtctctcttcaatgtaaaaagcttttatctgctt |
21362841 |
T |
|
| Q |
201 |
ttt |
203 |
Q |
| |
|
||| |
|
|
| T |
21362842 |
ttt |
21362844 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University